PlatinumCRISPR

Scan a genomic sequence (max 500 bp).

Please chose an organism first:

Enter a genomic sequence (max 500 bp)



The default sgRNA selected is 20 nucleotides, incoporating a G in the first nucleotide, either present in the sequence, or artifically. If requirements are different, please select sequence and re-test below. Re-testing is essential because one nucleotide can change the folding.

Re-Testing:


To test a single guide, please provide a guide sequence between 18-23 nucleotides long.
Example:
GAGGCGUCAUCGAUGACCGA


The default sgRNA target site is 20 nucleotides, but can be longer to incorporate promoter requirements for transcription. If transcribed from a U6 promoter, the first nucleotide needs to be a G, but this G does not need to be present in the targeted genome sequence. If transcribed in vitro from a T7 promoter, the first three nucleotides need to be G for efficient transcription. If the sgRNA is longer, additional nucleotides need to be added for folding.

Privacy | Legal | Freedom of Information | Cookies | Accessibility